Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.
AUTOR(ES)
Hermansen, R
RESUMO
The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.
ACESSO AO ARTIGO
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=190214Documentos Relacionados
- Altered restriction endonuclease cleavage pattern of simian virus 40 DNA.
- Specific Cleavage of Simian Virus 40 DNA by Restriction Endonuclease of Hemophilus Influenzae*
- Analysis of Simian Virus 40 DNA with the Restriction Enzyme of Haemophilus aegyptius, Endonuclease Z
- Integrated simian virus 40 sequences in transformed cell DNA: analysis using restriction endonucleases.
- A Colinear Map Relating the Simian Virus 40 (SV40) DNA Segments of Six Adenovirus-SV40 Hybrids to the DNA Fragments Produced by Restriction Endonuclease Cleavage of SV40 DNA