Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

AUTOR(ES)

Koper-Zwarthoff, E C

RESUMO

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Documentos Relacionados

• Translation of turnip yellow mosaic virus RNA in vitro: a closed and an open coat protein cistron.
• Complete nucleotide sequence of alfalfa mosaic virus RNA 4.
• 3'-Terminal nucleotide sequence of alfalfa mosaic virus RNA 4.
• Nucleotide sequence and structural determinants of specific binding of coat protein or coat protein peptides to the 3' untranslated region of alfalfa mosaic virus RNA 4.
• The nucleotide sequence of the 5' terminus of vesicular stomatitis virus RNA.