The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

AUTOR(ES)
RESUMO

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA OH. This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Documentos Relacionados