The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

AUTOR(ES)
RESUMO

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Documentos Relacionados