The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

AUTOR(ES)

Kilpatrick, M W

RESUMO

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.

Documentos Relacionados

• The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri.
• Sequence of an isoleucine tRNA from Mycoplasma mycoides sp. Capri.
• The nucleotide sequence of phenylalanine tRNA from Mycoplasma sp. (Kid)
• The nucleotide sequence of the 5S rRNA from Spiroplasma species BC3 and Mycoplasma mycoides sp. capri PG3.
• Nucleotide sequence of a tRNA cluster from Mycoplasma pneumoniae.