Cytokeratin 5
Mostrando 1-12 de 70 artigos, teses e dissertações.
-
1. Prognostic significance of inflammation-based prognostic scoring in patients with upper urinary tract urothelial carcinoma
ABSTRACT Objectives: To investigate whether Glasgow Prognostic Score has prognostic significance in patients with upper urinary urothelial carcinoma. Patients and methods: We retrospectively reviewed the clinical records of 74 patients with upper urinary urothelial carcinoma. We set the cut-off value for C-reactive protein as 1.0mg/dL, and 3.5mg/dL for alb
Int. braz j urol.. Publicado em: 27/06/2019
-
2. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects
Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%), meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wo
J. Appl. Oral Sci.. Publicado em: 2017-04
-
3. The role of intratumoral lymphovascular density in distinguishing primary from secondary mucinous ovarian tumors
OBJECTIVE: Ovarian mucinous metastases commonly present as the first sign of the disease and are capable of simulating primary tumors. Our aim was to investigate the role of intratumoral lymphatic vascular density together with other surgical-pathological features in distinguishing primary from secondary mucinous ovarian tumors. METHODS: A total of 124 ca
Clinics. Publicado em: 2014-12
-
4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
5. Basal cytokeratin as a potential marker of low risk of invasion in ductal carcinoma in situ
OBJECTIVES: Biological markers that predict the development of invasive breast cancer are needed to improve personalized therapy for patients diagnosed with ductal carcinoma in situ. We investigated the role of basal cytokeratin 5/6 in the risk of invasion in breast ductal carcinoma in situ. METHODS: We constructed tissue microarrays using 236 ductal carc
Clinics. Publicado em: 2013-05
-
6. Immunohistochemical profile of high-grade ductal carcinoma in situ of the breast
OBJECTIVE: To determine the frequency of the immunohistochemical profiles of a series of high-grade ductal carcinoma in situ of the breast. METHODS: One hundred and twenty-one cases of high-grade ductal carcinoma in situ, pure or associated with invasive mammary carcinoma, were identified from 2003 to 2008 and examined with immunohistochemistry for estrog
Clinics. Publicado em: 2013-05
-
7. Desenvolvimento placentário em quatis: evolução filogenética em carnívoros? / Placental development in quati: phylogenetic evolution in carnivores?
The importance of preservation of brazilian wild species is based on knowledge of their distribution, behavior in the wild and in captivity, and the detailed description of their reproductive biology in order to perpetuate the specie. One of the main impacts of this study is the scientific details of the uterine environment versus the process of placentation
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 13/12/2011
-
8. Modelos para a produção de eritropoietina recombinante humana in vivo e in vitro com vetores plasmideais em ovinos / Models for the production of human recombinant erythropoietin in vivo and in vitro with plasmidial vectors in ovine
Some post-translational modifications are necessary for the production of biopharmaceutical proteins, such as recombinant human erythropoietin (rhEPO), with a good specific action and a high biological activity. These modifications are obtained only by bioreactors based on eukaryotic cell as mammary cells. Bioreactors, in vivo or in vitro, with this kind of
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 24/02/2011
-
9. Triple-negative breast carcinomas are a heterogeneous entity that differs between young and old patients
OBJECTIVE: To compare the frequency and immunohistochemical profiles of triple-negative breast carcinomas in younger and older women. METHODS AND RESULTS: We selected patients diagnosed with triple-negative breast carcinomas. The groups examined were women who were 35 years old or younger between 1997 and 2007 (n = 74) and, for comparison, women who were 60
Clinics. Publicado em: 2010
-
10. Fatores hepatotróficos modulam a capacidade proliferativa em cultura primária de hepatócitos de ratos normais / Hepatotrophic factors modulate the proliferative potential in primary hepatocyte cultures of normal rats
A utilização de fatores hepatotróficos (FH) tem trazido importantes avanços no tratamento de algumas doenças hepáticas. A avaliação dos efeitos dessas substâncias pode ser feita com o uso de modelos in vivo, como a regeneração hepática após a hepatectomia parcial ou in vitro, como a cultura de hepatócitos, células estreladas ou outros tipos ce
Publicado em: 2010
-
11. Histopathological characterization of a syngeneic orthotopic murine bladder cancer model
PURPOSE: We developed and characterized by histopathology and immunohistochemistry a syngeneic murine bladder tumor model derived from the MB49 tumor cell line. MATERIALS AND METHODS: Bladder tumor implantation was achieved by intravesical instillation of 5 x 10(5) MB49 tumor cells in C57BL/6 mice. A chemical lesion of the bladder was performed in order to p
International braz j urol. Publicado em: 2008-03
-
12. Avaliação do perfil de citoqueratinas e marcadores de proliferação celular em lesões odontogenicas : queratocisto odontogenico, cisto odontogenico ortoqueratinizado e fibroma odontogenico central / Avaliation of cytokeratin profile and celular proliferation markers in odontogenic lesions : odontogenic keratocyst, odontogenic orthokeratinized cyst and central odontogenic fibroma
A região bucomaxilofacial é freqüentemente afetada por lesões císticas e tumorais que apresentam características clínicas e histológicas heterogêneas cuja origem está associada a diversos estágios da odontogênese. Entre as lesões císticas mais freqüentes, temos o queratocisto odontogênico (QO), enquanto o cisto odontogênico ortoqueratinizado
Publicado em: 2007